COVID-19 ... how we cope :)

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Frank Dixon
    replied
    Sid,

    Please accept my sincere condolences for your family's loss.

    Thank you for the url references.

    I had heard of Mr. Kirsch, one of your references, in an entrepreneurial setting, as he is a major success story in the computer science and electrical engineering worlds. His education comes from the Massachusetts Institute of Technology, in electrical engineering and computer science. He has a significant fortune, running into eight figures in dollars. But, insofar as I can tell, he has no education or experience in medical matters. His associates from a group he had founded, to explore alternative solutions for COVID, have left him, once he began making questionable claims about damage from COVID vaccines. Certainly, the concept of usage of an already existing medication to relieve COVID is a very attractive one; it is certainly possible.

    I do not claim to be a medical expert, but I am a scientist, and have been doing my best to separate sound science from the vast variety of material which is not, since the start of the pandemic. In my childhood, I lived for three years in a Caribbean country which had only a few years before been virtually totally cleared of the virus malaria, and I put time and effort into learning about it, both then and later. It is spread by mosquitos; it took a long time for that to be figured out. Jungle regions in Central and South America still are havens for it today.

    It is certainly possible for a person to die after receiving a COVID vaccine; I believe there is a small number of cases like this. Perhaps the vaccine did not work on that person, for whatever reason, and it may have made matters worse. Design of vaccines cannot be able to cover every single eventuality; that is also the case for vaccines created prior to COVID. Indeed, some, or many, people may be able to fight off COVID, or other viruses, through their natural body defenses. Physical fitness, lifestyle, and personal genetic and / or environmental characteristics may do it. A lot of it is probably nothing more than good or bad fortune.

    I believe that the Pfizer and Moderna vaccines help prevent COVID-19; we have a lot of data now, and this is the one firm conclusion. Britain has been having a lot of problems recently because, in my view, their main vaccine, Astra Zeneca, which was British developed, with government assistance, has been shown to NOT WORK on the Omicron variant. This information was published a few weeks ago. The Russian and Chinese vaccines are also NOT EFFECTIVE on Omicron. None of these three vaccines are m-rna based. Britain has exceptionally high vaccine uptake numbers, although their initial vaccine dose numbers are lower than Canada's; they have a very high third dose usage. But their case levels remain very high, and their death totals are going up quickly.

    I believe I may have caught a mild form of COVID in mid-February 2020, after talking for a few minutes, without social distancing (the term hadn't been invented yet) with a friend of mine who had recently visited New York City. We were a couple of feet apart when we were speaking; just having a normal conversation for those pre-pandemic times. It was at a City of Kingston open house hearing on a development matter, at Kingston City Hall; this is one of our common interests. This was perhaps four weeks before the pandemic had been officially declared anywhere, and the virus phenomenon was merely a rumor. My friend had been visiting her grandson who is taking a special arts performance program in the Big Apple. She was very ill for a few days, when she returned to Kingston, but managed to recover. I was ill for a couple of days, and then recovered. We put it together later that it was probably COVID, which was by then formally named. The pandemic was declared by the WHO about March 11, 2020. Neither of us went in for a medical examination, which in hindsight was probably an unfortunate omission. Among American centers, COVID hit the New York area very hard at first, mainly through travelers bringing it from Europe, and New York's airport is a major transit point. In Europe, it hit northern Italy first, and very hard. There had been a significant sized group of Chinese visitors to northern Italy early in 2020; they likely brought the virus with them. In Canada, it hit the province of Quebec early, and very hard; there was a confluence of strains from Quebec people vacationing in both New York and Florida, together with others vacationing in France. This was in March and April 2020.

    Leave a comment:


  • Bob Armstrong
    replied
    COVID-19 Conspiracy Theories
    (A recap, plus more, from prior posts)

    COVID-19 Conspiracy Theory # 1 (Deliberate Release)

    There is a world conspiracy to suppress the best practice for prevention of/ treatment of COVID-19 among:

    1. All world governments;
    2. All global health organizations that are mainstream.
    3. Almost all world scientists (Those opposed to mainstream medicine are still a small minority in the world).
    4. Almost all world physicians
    5. All multi-national pharmaceutical companies
    6. The world's Oligarchy.

    This conspiracy is most willing to tolerate a very high death and serious sickness total (Much higher than necessary) in order to achieve their covert goals, one of which is to maximize the profits of the multi-national pharmaceuticals; another can be to increase the control of the governments over their citizens by imposing restraints on the basis of a world emergency.


    My Response

    Possible but unlikely.....the coordination would have to be totally covert and impeccable. Surely there would be a whistleblower! There has been none yet. It is, however, not pure speculation, as the conspirators all would have the same goal......all rowing in the same direction.

    There is a whole universe of non-human viruses out there, which are transferable to humans, and make them sick. So there could have been a natural virus transfer from an animal to a human.

    But it is true that our world capitalist system sees nothing wrong with the multi-national pharmaceutical companies making obscene profits off human illness.

    Also, I have personally seen a very professional video making this claim, even to the very bench the female lab technician from the Wuhan lab sat on outside of Wuhan, where she set on the bench the dry ice container containing the virus, to let it escape! Big money is propelling this theory! I will admit it is quite possible, though unlikely......it is just too Machiavellian even for mankind.

    COVID-19 Conspiracy Theory # 2 (Petri Dish)

    The SARSCov-2 virus was artificially created in a "Petri Dish" in a laboratory.

    Evidence of this, and that USA and China were working together, is claimed to be found in the interpretation of Dr. Fauci's e-mails: https://www.youtube.com/watch?v=P5TvU4q2J1s.

    My Response

    Certainly possible, but the evidence to me is so far insufficient. It is quite logical that military see value in Bio-weapons. I have also seen allegations of the military combining SARS and the HIV virus as well.

    But there are many scientific articles on the universe of natural non-human viruses out there waiting to make humans sick. There are articles claiming evidence for SARS-CoV-2 related coronaviruses circulating in bats and pangolins in Southeast Asia and being the natural source of the virus : https://www.nature.com/articles/s414...240-1..(21/2/9).

    It has been argued that the structure of this virus is different than the similar ones found in animals. But there is scientific evidence against this alleged evidence.

    But it does seem to me that the case is not yet totally made against Conspiracy Theory # 2

    COVID-19 Conspiracy Theory # 3 (Inadvertent Escape)

    A military-created virus (A bio-weapon) accidentally escaped from the Wuhan Lab in China somehow (Not deliberate).

    My Response

    Perhaps - China has so stonewalled on any on-site investigation in Wuhan that there is little "direct" evidence on anything. There is admittedly some "circumstantial" evidence.

    COVID-19 Conspiracy Theory # 4 (ET Hostility)

    Some covert ET Societies of Earth conspired together to make the world sick, in order to reduce Earth's over-population problem, and make more room for more ET immigrants.

    My Response

    There is good evidence that most covert ET Societies of Earth are well-intentioned re mankind.

    But 5.5 MILLION world deaths in 2020-2021 from COVID-19 does practically nothing to cull humanity, when the population of the Earth is now 7.7 BILLION.

    ~ Bob A (T-S/P)

    Leave a comment:


  • Sid Belzberg
    replied
    Originally posted by Erik Malmsten View Post

    Sorry about your mother-in-law.

    In Ontario a new round of long-term care deaths is about to happen. There are 98 homes with outbreaks among staff and many staff have isolate, leaving nobody in the building to clean and feed the seniors. The provincial minister in charge of long-term care homes has resigned.
    Thank you Eric, Dilip, and Neil, this horrific scene is being played out across North America in hospitals and eldercare facilities continuously. Here are details
    about this.

    https://rumble.com/vss3ph-proof-docs...l-rate-in.html

    Leave a comment:


  • Sid Belzberg
    replied
    Originally posted by Frank Dixon View Post
    Sid: I agree there is no substitute for practical experience, so doctors who have treated COVID patients are very valuable.
    I am looking more at the mathematical side of the pandemic, as that is my area of most expertise. Advanced knowledge of the mathematics of epidemics is greatly lacking; we haven't had one on a world scale for 100 years, and an enormous amount of advanced math has been developed since then, but not for specific applied research into the field. It is a matter of knowing what methods to apply, to produce accurate models, in an age of data uncertainty. There is a lack of consensus right now, just at the time when we need it most. We will certainly see many papers in the years ahead.
    I've been taking a look at some very interesting, as yet unpublished material I obtained from the late Sir W. Hodge, British mathematician, who worked with my late father in the late 1960 and early 1970s. I think Hodge's ideas have potential, since in this work, he looked at chaotic situations with missing / incomplete data, in scenarios of epidemic growth, which is where we are now. I think that Markov chains and stochastic processes have to be combined with Hodge's work. I've had some success with this, using Canadian data from earlier phases of the pandemic.
    My current estimates show an average of 50 deaths per day, for Ontario, from January 1 through April 30. Those are very scary numbers; some 6,000 new deaths. I think over half those deaths will be among the unvaccinated population, which comprises about 10 to 12 per cent of adults right now.
    My final observation for this post is wondering whether it is pure coincidence that Wuhan, the Chinese city where the pandemic started about two years ago, just happens to be the site of their national centre for coronavirus research; and some of the scientists who worked there have since been muzzled or been made to disappear. The Chinese claimed that it was animal-to-human interaction, through their open-air markets, specifically with live bats which were on sale in Wuhan, which caused COVID-19. I am not so sure that is the case. Perhaps we will never know the full story. The virus is holding the world hostage right now.
    https://twitter.com/MichaelPSenger/s...31901173186561

    https://stevekirsch.substack.com/p/i...XAX1RcFq9PjWxM

    Leave a comment:


  • Sid Belzberg
    replied
    Originally posted by Egidijus Zeromskis View Post

    After the search for "CTCCTCGGCGGGCACGTAG" at BLAST, let's look the Japanese patent
    JP 2017197545-A/7090: MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEPTIDES

    With this result
    Code:
    Range 1: 2733 to 2751GenBankGraphics Next Match Previous Match 
    38.2 bits(19) 0.16 19/19(100%) 0/19(0%) Plus/Minus
    Query 1 CTCCTCGGCGGGCACGTAG 19 ||||||||||||||||||| Sbjct 2751 CTCCTCGGCGGGCACGTAG 2733
    Let's open the patent and the sequence in it from 2733 to 2751 letters:

    https://www.ncbi.nlm.nih.gov/nucleotide/LZ959695.1?report=genbank&log$=nuclalign&blast_rank=33&RID=YBE1YC4T01R

    2701 gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc

    This is quite different than a CTCCTCGGCGGGCACGTAG search term. Hopefully you'll be able to explain this discrepancy. Quoting you: "The order of the letters is what matters."


    As for your question: I switched from a biology course to a practical - technical drawing - ages ago.
    To refresh your memory from the biology course you studied all those years ago the "letters" actually represent nucleotides consisting of Cytosine Guanine Adenine and Thymine. DNA has two complementary strands where the Cytosine always binds to Guanine and Adenine always binds to Thymine. The genetic sequence in the patent you got is actually the complementary strand to CTCCTCGGCGGGCACGTAG where we get GAGGAGCCGCCCGTCGCATC . The bolded part appears in the tail end of what you bolded "gagga g".
    I am not an expert on the NIH BLASTn query system but I am very sure they do not mismatch sequences to complementary sequences recorded in the patent database. That appears to be what your main issue is.
    On the diagram, I gave you you can do the same type of query with the various amino acid protein sequences as well and match them up to protein sequences in the patent database and you will see that Moderna comes up consistently. It is impossible for this to be a coincidence. This was correctly pointed out by dissenting views to the post in the article you cited in one of your previous posts.
    Last edited by Sid Belzberg; Yesterday, 06:31 PM.

    Leave a comment:


  • Egidijus Zeromskis
    replied
    Originally posted by Sid Belzberg View Post
    Sorry, your question makes no sense to me, The order of the letters is what matters. Have you ever taken a basic course in genetics? The discussion is interesting that you posted. Bottom line, as I outlined in the graphic Modernas patents are all over the pathogenic area of the virus aka the spike proteins. If I found a watch on a beach I could say that it occurred in nature albeit unlikely but it would be a stretch if the patent office had already patented many of the parts in the watch.
    After the search for "CTCCTCGGCGGGCACGTAG" at BLAST, let's look the Japanese patent
    JP 2017197545-A/7090: MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEPTIDES

    With this result
    Code:
    Range 1: 2733 to 2751GenBankGraphics Next Match Previous Match 
    38.2 bits(19) 0.16 19/19(100%) 0/19(0%) Plus/Minus
    Query 1 CTCCTCGGCGGGCACGTAG 19 ||||||||||||||||||| Sbjct 2751 CTCCTCGGCGGGCACGTAG 2733
    Let's open the patent and the sequence in it from 2733 to 2751 letters:

    https://www.ncbi.nlm.nih.gov/nucleotide/LZ959695.1?report=genbank&log$=nuclalign&blast_rank=33&RID=YBE1YC4T01R

    2701 gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc

    This is quite different than a CTCCTCGGCGGGCACGTAG search term. Hopefully you'll be able to explain this discrepancy. Quoting you: "The order of the letters is what matters."


    As for your question: I switched from a biology course to a practical - technical drawing - ages ago.

    Leave a comment:


  • Sid Belzberg
    replied
    Sorry, your question makes no sense to me, The order of the letters is what matters. Have you ever taken a basic course in genetics? The discussion is interesting that you posted with many dissenting views to the original post. Bottom line, as I outlined in the picture, Modernas patents are all over the pathogenic area of the virus aka the spike proteins. If I found a watch on a beach I could say that it occurred in nature albeit unlikely but it would be even more of a stretch if the patent office had already registered many of the parts in the watch with the inventor.
    Last edited by Sid Belzberg; Yesterday, 11:46 PM.

    Leave a comment:


  • Egidijus Zeromskis
    replied
    Originally posted by Sid Belzberg View Post
    What do you mean "exactly", I ran the identical sequence and it linked to the Moderns Patent as described in the article.
    From other sources:

    "So, CTCCTCGGCGGGCACGTAG is whats showing up in the virus.

    Does that mean what Moderna has patented is GAGGAGCCGCCCGTGCATC?" Answer was Yes.


    As I asked before - What is a difference in these letters sequence?

    Seems people at https://news.ycombinator.com/item?id=29938732 also are not convinced by this match.

    Leave a comment:


  • Sid Belzberg
    replied
    Originally posted by Egidijus Zeromskis View Post

    As I wrote those letter do not match for me 100% percent.
    For the sake of curiosity, I deleted several last letters and ran the search. It popped me even older patents like
    "Highly thermophilic bacterium-derived protein and gene encoding it"
    Patent: JP 2002325574-A 10 12-NOV-2002.

    What do you mean "exactly", I ran the identical sequence and it linked to the Moderns Patent as described in the article.

    Originally posted by Egidijus Zeromskis View Post
    wth that mean?
    Why the aggressive language? "WTH" or did you just mean to put in "what"? You found another patented sequence, so what? The point of this article is that this unique sequence has not been recorded in nature by the gene bank but is recorded as part of Moderna's patents. It is unequivocal proof that the virus was man made and made for Moderna to profit from the vaccines that turn your body into a pathogenic spike protein factory that is the same spike protein found in SARSCOV2.
    As per the graphic Moderna's patents are all over this thing.
    Last edited by Sid Belzberg; Monday, 17th January, 2022, 11:14 AM.

    Leave a comment:


  • Egidijus Zeromskis
    replied
    Originally posted by Sid Belzberg View Post

    here is the link to the Blast site Gene bank.
    https://blast.ncbi.nlm.nih.gov/Blast...ST_PAGE=blastn
    type in CTCCTCGGCGGGCACGTAG as described in the last part of the article put in the same settings as described and then you will see it links to the 2015 Moderna patent as described in the article.
    The first part of the article proves that this sequence or the corresponding amino acid sequence has never been found or recorded in any wild type SARSCOV based on the gene database and indeed was only found as patented synthesized oligonucleotides including the 2015-2017 Moderna Patents.
    This was long before SARSCOV2 was publicly known hence very likely made in the lab and worst was in the planning for many years.

    Moderna Screen Shot 2022-01-16 at 11.17.00 PM.png
    As I wrote those letter do not match for me 100% percent.
    For the sake of curiosity, I deleted several last letters and ran the search. It popped me even older patents like
    "Highly thermophilic bacterium-derived protein and gene encoding it"
    Patent: JP 2002325574-A 10 12-NOV-2002.

    wth that mean?



    Leave a comment:


  • Bob Armstrong
    replied
    Vaccinated vs Unvaccinated

    The Americas - USA


    "it may seem like the gap between the two groups is narrowing—and that the “pandemic of the unvaccinated” is now a misnomer."

    But these Charts Show That COVID-19 Is Still the" Pandemic of the Unvaccinated".


    https://time.com/6138566/pandemic-of...lctg=141335524

    ~ Bob A (T-S/P)

    Leave a comment:


  • Dilip Panjwani
    replied
    Originally posted by Sid Belzberg View Post


    "experts" are mostly pharma corrupted bureaucrats like Dr. Fraudsci. Interesting that the few areas that have crushed the curve such as Uttar Pradash, Bangladesh, MexicoCity etc using early treatments are immediately proclaimed to have inaccurate data, Before they crushed the curve with early treatment the data was considered accurate.
    True experts are Dr's that have successfully treated hundreds of thousands of COVID patients. Show me any expert that matches this description in Health Canada, US government COVID response team, UK Health services etc. Spoiler alert-You won't Here are true experts

    https://earlycovidcare.org/our-expert/


    The big lie is that no treatments exist and the only solution is vaccines, You don't have to look very far to see the science says otherwise not to mention entire regions that crushed the curve with early early therapies such as the State of Florida with monoclonal antibodies among other things. By the way did you know that the US Federal government tried to deny Florida monoclonal antibodies when they had success with it? Florida has low vaccination rates, no mask mandates, no vaccine mandates, no supression of early treatments, When they started errecting monoclonal antibody treatment centres all over the state starting in August by Ocotber they are among the lowest deaths per 100,000 in theUS. Before that, they were among the highest.

    https://earlycovidcare.org/review-the-evidence/

    https://www.nejm.org/doi/full/10.1056/NEJMoa2109682




    Yes as it does in a vaccinated person. For vaccinated people it is even worst as the efficacy of boosters last only a short while as the vaccine were designed for a very specific virus that is long gone. Here in Ontario the percentage of vaccinate people hospitalized is greater than unvaccinated. Yes it is true that the unvaccinated people as a percentage of their group is higher but the blunt fact is that 70% of the hospitalizations in Ontario are with vaccinated people.
    Here is what is going on in Quebec nursing homes with 100% vaccinated people. The reason for so many deaths from a relatively mild virus is that they do no treat their patients at all. That has been the case since 2020. It is simply mass murder of the elderly. I lost my mother-in-law last week at the Jewish Eldercare facility in Montreal where she was denied vitamin b12 that without it she chokes on food. In effect, they starved her to death with their policy of no treatment of any kind with vitamin supplements. Vitamin b12 has some efficacy for COVID hence she was denied it.

    https://covexit.com/covid-19-taking-...l-vaccination/
    May your mother-in-law rest in Heavenly peace, Sid...

    Leave a comment:


  • Neil Frarey
    replied
    Sid, please accept my deepest condolences for your family's loss.

    Leave a comment:


  • Bob Armstrong
    replied
    Tipping Point

    There is a sociological theory that a minority view, to make progress, must reach the figure of a very committed 25% of the population. This is the "tipping point" beyond which the minority now will steadily move to replace the status quo majority.

    A certain percentage of the world population believes that there is good science to establish that the best practice for prevention of/treatment of COVID-19 is NOT vaccination. This minority position is being rejected by the majority at the present time........the majority percentage of supporters of vaccination is quite high in the world population..

    When, if ever, does this minority expect to achieve a following of 25% of the world population?

    ~ Bob A (T-S/P)

    Leave a comment:


  • Erik Malmsten
    replied
    Originally posted by Sid Belzberg View Post


    Yes as it does in a vaccinated person. For vaccinated people it is even worst as the efficacy of boosters last only a short while as the vaccine were designed for a very specific virus that is long gone. Here in Ontario the percentage of vaccinate people hospitalized is greater than unvaccinated. Yes it is true that the unvaccinated people as a percentage of their group is higher but the blunt fact is that 70% of the hospitalizations in Ontario are with vaccinated people.
    Here is what is going on in Quebec nursing homes with 100% vaccinated people. The reason for so many deaths from a relatively mild virus is that they do no treat their patients at all. That has been the case since 2020. It is simply mass murder of the elderly. I lost my mother-in-law last week at the Jewish Eldercare facility in Montreal where she was denied vitamin b12 that without it she chokes on food. In effect, they starved her to death with their policy of no treatment of any kind with vitamin supplements. Vitamin b12 has some efficacy for COVID hence she was denied it.

    https://covexit.com/covid-19-taking-...l-vaccination/
    Sorry about your mother-in-law.

    In Ontario a new round of long-term care deaths is about to happen. There are 98 homes with outbreaks among staff and many staff have isolate, leaving nobody in the building to clean and feed the seniors. The provincial minister in charge of long-term care homes has resigned.
    Last edited by Erik Malmsten; Sunday, 16th January, 2022, 07:41 PM.

    Leave a comment:

Working...
X