COVID-19 ... how we cope :)

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Originally posted by Sid Belzberg View Post
    What do you mean "exactly", I ran the identical sequence and it linked to the Moderns Patent as described in the article.
    From other sources:

    "So, CTCCTCGGCGGGCACGTAG is whats showing up in the virus.

    Does that mean what Moderna has patented is GAGGAGCCGCCCGTGCATC?" Answer was Yes.


    As I asked before - What is a difference in these letters sequence?

    Seems people at https://news.ycombinator.com/item?id=29938732 also are not convinced by this match.

    Comment


    • Sorry, your question makes no sense to me, The order of the letters is what matters. Have you ever taken a basic course in genetics? The discussion is interesting that you posted with many dissenting views to the original post. Bottom line, as I outlined in the picture, Modernas patents are all over the pathogenic area of the virus aka the spike proteins. If I found a watch on a beach I could say that it occurred in nature albeit unlikely but it would be even more of a stretch if the patent office had already registered many of the parts in the watch with the inventor.
      Last edited by Sid Belzberg; Tuesday, 18th January, 2022, 11:46 PM.

      Comment


      • Originally posted by Sid Belzberg View Post
        Sorry, your question makes no sense to me, The order of the letters is what matters. Have you ever taken a basic course in genetics? The discussion is interesting that you posted. Bottom line, as I outlined in the graphic Modernas patents are all over the pathogenic area of the virus aka the spike proteins. If I found a watch on a beach I could say that it occurred in nature albeit unlikely but it would be a stretch if the patent office had already patented many of the parts in the watch.
        After the search for "CTCCTCGGCGGGCACGTAG" at BLAST, let's look the Japanese patent
        JP 2017197545-A/7090: MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEPTIDES

        With this result
        Code:
        Range 1: 2733 to 2751GenBankGraphics Next Match Previous Match 
        38.2 bits(19) 0.16 19/19(100%) 0/19(0%) Plus/Minus
        Query 1 CTCCTCGGCGGGCACGTAG 19 ||||||||||||||||||| Sbjct 2751 CTCCTCGGCGGGCACGTAG 2733
        Let's open the patent and the sequence in it from 2733 to 2751 letters:

        https://www.ncbi.nlm.nih.gov/nucleotide/LZ959695.1?report=genbank&log$=nuclalign&blast_rank=33&RID=YBE1YC4T01R

        2701 gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc

        This is quite different than a CTCCTCGGCGGGCACGTAG search term. Hopefully you'll be able to explain this discrepancy. Quoting you: "The order of the letters is what matters."


        As for your question: I switched from a biology course to a practical - technical drawing - ages ago.

        Comment


        • Originally posted by Egidijus Zeromskis View Post

          After the search for "CTCCTCGGCGGGCACGTAG" at BLAST, let's look the Japanese patent
          JP 2017197545-A/7090: MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF ONCOLOGY-RELATED PROTEINS AND PEPTIDES

          With this result
          Code:
          Range 1: 2733 to 2751GenBankGraphics Next Match Previous Match 
          38.2 bits(19) 0.16 19/19(100%) 0/19(0%) Plus/Minus
          Query 1 CTCCTCGGCGGGCACGTAG 19 ||||||||||||||||||| Sbjct 2751 CTCCTCGGCGGGCACGTAG 2733
          Let's open the patent and the sequence in it from 2733 to 2751 letters:

          https://www.ncbi.nlm.nih.gov/nucleotide/LZ959695.1?report=genbank&log$=nuclalign&blast_rank=33&RID=YBE1YC4T01R

          2701 gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc

          This is quite different than a CTCCTCGGCGGGCACGTAG search term. Hopefully you'll be able to explain this discrepancy. Quoting you: "The order of the letters is what matters."


          As for your question: I switched from a biology course to a practical - technical drawing - ages ago.
          To refresh your memory from the biology course you studied all those years ago the "letters" actually represent nucleotides consisting of Cytosine Guanine Adenine and Thymine. DNA has two complementary strands where the Cytosine always binds to Guanine and Adenine always binds to Thymine. The genetic sequence in the patent you got is actually the complementary strand to CTCCTCGGCGGGCACGTAG where we get GAGGAGCCGCCCGTCGCATC . The bolded part appears in the tail end of what you bolded "gagga g".
          I am not an expert on the NIH BLASTn query system but I am very sure they do not mismatch sequences to complementary sequences recorded in the patent database. That appears to be what your main issue is.
          On the diagram, I gave you you can do the same type of query with the various amino acid protein sequences as well and match them up to protein sequences in the patent database and you will see that Moderna comes up consistently. It is impossible for this to be a coincidence. This was correctly pointed out by dissenting views to the post in the article you cited in one of your previous posts.
          Last edited by Sid Belzberg; Tuesday, 18th January, 2022, 06:31 PM.

          Comment


          • Originally posted by Frank Dixon View Post
            Sid: I agree there is no substitute for practical experience, so doctors who have treated COVID patients are very valuable.
            I am looking more at the mathematical side of the pandemic, as that is my area of most expertise. Advanced knowledge of the mathematics of epidemics is greatly lacking; we haven't had one on a world scale for 100 years, and an enormous amount of advanced math has been developed since then, but not for specific applied research into the field. It is a matter of knowing what methods to apply, to produce accurate models, in an age of data uncertainty. There is a lack of consensus right now, just at the time when we need it most. We will certainly see many papers in the years ahead.
            I've been taking a look at some very interesting, as yet unpublished material I obtained from the late Sir W. Hodge, British mathematician, who worked with my late father in the late 1960 and early 1970s. I think Hodge's ideas have potential, since in this work, he looked at chaotic situations with missing / incomplete data, in scenarios of epidemic growth, which is where we are now. I think that Markov chains and stochastic processes have to be combined with Hodge's work. I've had some success with this, using Canadian data from earlier phases of the pandemic.
            My current estimates show an average of 50 deaths per day, for Ontario, from January 1 through April 30. Those are very scary numbers; some 6,000 new deaths. I think over half those deaths will be among the unvaccinated population, which comprises about 10 to 12 per cent of adults right now.
            My final observation for this post is wondering whether it is pure coincidence that Wuhan, the Chinese city where the pandemic started about two years ago, just happens to be the site of their national centre for coronavirus research; and some of the scientists who worked there have since been muzzled or been made to disappear. The Chinese claimed that it was animal-to-human interaction, through their open-air markets, specifically with live bats which were on sale in Wuhan, which caused COVID-19. I am not so sure that is the case. Perhaps we will never know the full story. The virus is holding the world hostage right now.
            https://twitter.com/MichaelPSenger/s...31901173186561

            https://stevekirsch.substack.com/p/i...XAX1RcFq9PjWxM

            Comment


            • Originally posted by Erik Malmsten View Post

              Sorry about your mother-in-law.

              In Ontario a new round of long-term care deaths is about to happen. There are 98 homes with outbreaks among staff and many staff have isolate, leaving nobody in the building to clean and feed the seniors. The provincial minister in charge of long-term care homes has resigned.
              Thank you Eric, Dilip, and Neil, this horrific scene is being played out across North America in hospitals and eldercare facilities continuously. Here are details
              about this.

              https://rumble.com/vss3ph-proof-docs...l-rate-in.html

              Comment


              • COVID-19 Conspiracy Theories
                (A recap, plus more, from prior posts)

                COVID-19 Conspiracy Theory # 1 (Deliberate Release)

                There is a world conspiracy to suppress the best practice for prevention of/ treatment of COVID-19 among:

                1. All world governments;
                2. All global health organizations that are mainstream.
                3. Almost all world scientists (Those opposed to mainstream medicine are still a small minority in the world).
                4. Almost all world physicians
                5. All multi-national pharmaceutical companies
                6. The world's Oligarchy.

                This conspiracy is most willing to tolerate a very high death and serious sickness total (Much higher than necessary) in order to achieve their covert goals, one of which is to maximize the profits of the multi-national pharmaceuticals; another can be to increase the control of the governments over their citizens by imposing restraints on the basis of a world emergency.


                My Response

                Possible but unlikely.....the coordination would have to be totally covert and impeccable. Surely there would be a whistleblower! There has been none yet. It is, however, not pure speculation, as the conspirators all would have the same goal......all rowing in the same direction.

                There is a whole universe of non-human viruses out there, which are transferable to humans, and make them sick. So there could have been a natural virus transfer from an animal to a human.

                But it is true that our world capitalist system sees nothing wrong with the multi-national pharmaceutical companies making obscene profits off human illness.

                Also, I have personally seen a very professional video making this claim, even to the very bench the female lab technician from the Wuhan lab sat on outside of Wuhan, where she set on the bench the dry ice container containing the virus, to let it escape! Big money is propelling this theory! I will admit it is quite possible, though unlikely......it is just too Machiavellian even for mankind.

                COVID-19 Conspiracy Theory # 2 (Petri Dish)

                The SARSCov-2 virus was artificially created in a "Petri Dish" in a laboratory.

                Evidence of this, and that USA and China were working together, is claimed to be found in the interpretation of Dr. Fauci's e-mails: https://www.youtube.com/watch?v=P5TvU4q2J1s.

                My Response

                Certainly possible, but the evidence to me is so far insufficient. It is quite logical that military see value in Bio-weapons. I have also seen allegations of the military combining SARS and the HIV virus as well.

                But there are many scientific articles on the universe of natural non-human viruses out there waiting to make humans sick. There are articles claiming evidence for SARS-CoV-2 related coronaviruses circulating in bats and pangolins in Southeast Asia and being the natural source of the virus : https://www.nature.com/articles/s414...240-1..(21/2/9).

                It has been argued that the structure of this virus is different than the similar ones found in animals. But there is scientific evidence against this alleged evidence.

                But it does seem to me that the case is not yet totally made against Conspiracy Theory # 2

                COVID-19 Conspiracy Theory # 3 (Inadvertent Escape)

                A military-created virus (A bio-weapon) accidentally escaped from the Wuhan Lab in China somehow (Not deliberate).

                My Response

                Perhaps - China has so stonewalled on any on-site investigation in Wuhan that there is little "direct" evidence on anything. There is admittedly some "circumstantial" evidence.

                COVID-19 Conspiracy Theory # 4 (ET Hostility)

                Some covert ET Societies of Earth conspired together to make the world sick, in order to reduce Earth's over-population problem, and make more room for more ET immigrants.

                My Response

                There is good evidence that most covert ET Societies of Earth are well-intentioned re mankind.

                But 5.5 MILLION world deaths in 2020-2021 from COVID-19 does practically nothing to cull humanity, when the population of the Earth is now 7.7 BILLION.

                ~ Bob A (T-S/P)

                Comment


                • Sid,

                  Please accept my sincere condolences for your family's loss.

                  Thank you for the url references.

                  I had heard of Mr. Kirsch, one of your references, in an entrepreneurial setting, as he is a major success story in the computer science and electrical engineering worlds. His education comes from the Massachusetts Institute of Technology, in electrical engineering and computer science. He has a significant fortune, running into eight figures in dollars. But, insofar as I can tell, he has no education or experience in medical matters. His associates from a group he had founded, to explore alternative solutions for COVID, have left him, once he began making questionable claims about damage from COVID vaccines. Certainly, the concept of usage of an already existing medication to relieve COVID is a very attractive one; it is certainly possible.

                  I do not claim to be a medical expert, but I am a scientist, and have been doing my best to separate sound science from the vast variety of material which is not, since the start of the pandemic. In my childhood, I lived for three years in a Caribbean country which had only a few years before been virtually totally cleared of the virus malaria, and I put time and effort into learning about it, both then and later. It is spread by mosquitos; it took a long time for that to be figured out. Jungle regions in Central and South America still are havens for it today.

                  It is certainly possible for a person to die after receiving a COVID vaccine; I believe there is a small number of cases like this. Perhaps the vaccine did not work on that person, for whatever reason, and it may have made matters worse. Design of vaccines cannot be able to cover every single eventuality; that is also the case for vaccines created prior to COVID. Indeed, some, or many, people may be able to fight off COVID, or other viruses, through their natural body defenses. Physical fitness, lifestyle, and personal genetic and / or environmental characteristics may do it. A lot of it is probably nothing more than good or bad fortune.

                  I believe that the Pfizer and Moderna vaccines help prevent COVID-19; we have a lot of data now, and this is the one firm conclusion. Britain has been having a lot of problems recently because, in my view, their main vaccine, Astra Zeneca, which was British developed, with government assistance, has been shown to NOT WORK on the Omicron variant. This information was published a few weeks ago. The Russian and Chinese vaccines are also NOT EFFECTIVE on Omicron. None of these three vaccines are m-rna based. Britain has exceptionally high vaccine uptake numbers, although their initial vaccine dose numbers are lower than Canada's; they have a very high third dose usage. But their case levels remain very high, and their death totals are going up quickly.

                  I believe I may have caught a mild form of COVID in mid-February 2020, after talking for a few minutes, without social distancing (the term hadn't been invented yet) with a friend of mine who had recently visited New York City. We were a couple of feet apart when we were speaking; just having a normal conversation for those pre-pandemic times. It was at a City of Kingston open house hearing on a development matter, at Kingston City Hall; this is one of our common interests. This was perhaps four weeks before the pandemic had been officially declared anywhere, and the virus phenomenon was merely a rumor. My friend had been visiting her grandson who is taking a special arts performance program in the Big Apple. She was very ill for a few days, when she returned to Kingston, but managed to recover. I was ill for a couple of days, and then recovered. We put it together later that it was probably COVID, which was by then formally named. The pandemic was declared by the WHO about March 11, 2020. Neither of us went in for a medical examination, which in hindsight was probably an unfortunate omission. Among American centers, COVID hit the New York area very hard at first, mainly through travelers bringing it from Europe, and New York's airport is a major transit point. In Europe, it hit northern Italy first, and very hard. There had been a significant sized group of Chinese visitors to northern Italy early in 2020; they likely brought the virus with them. In Canada, it hit the province of Quebec early, and very hard; there was a confluence of strains from Quebec people vacationing in both New York and Florida, together with others vacationing in France. This was in March and April 2020.

                  Comment


                  • Originally posted by Pargat Perrer View Post

                    Protein found on infected cells protects virus from immune system; remdesivir helps prevent hospitalization (msn.com)


                    "Remdesivir keeps high-risk patients out of the hospital

                    Gilead Sciences Inc's intravenous antiviral drug remdesivir helped keep high-risk COVID-19 patients out of the hospital in a randomized trial, the company announced. The 562 patients in the study all had conditions that increased their risk for becoming critically ill. Half received three days of treatment with remdesivir - sold under the brand name Veklury - while the rest received a placebo. Four weeks later, 5.3% of patients in the placebo group had been hospitalized or died, compared to 0.7% of those who received remdesivir. That translated into an 87% lower risk of hospitalization or death. Remdesivir-treated patients also had significantly fewer medical visits, the company said. The drug is currently authorized for emergency use in hospitalized patients. "These latest data show remdesivir's potential to help high-risk patients recover before they get sicker and stay out of the hospital altogether," study leader Dr. Robert Gottlieb of Baylor University Medical Center said in a statement. His team plans to formally report the data at an upcoming medical conference."

                    Study of 1,282 patients led by Sunnybrook in the Canadian Medical Association Journal states that remdesivir injection could have a "modest but significant effect" decreasing the need for mechanical ventilation by approximately 50 per cent. The study also found patients on remdesivir came off oxygen and ventilators sooner. In-hospital mortality was slightly lower in the remdesivir group at 18.7 per cent, compared to 22.6 in the control group.

                    A McGill study in the Oxford Journal Open Forum Infectious Diseases states Redesivir prevents the hospitalization of 1 out of every 28 patients. Hospital costs average $21,752 per admission.The new Pfizer antiviral pill Paxlovid (Nirmatreivir-Ritonavir) prevents 1 out of every 24. Sotrovimab 1 out of 25. Casirivimab-Imdevimab or Bamlanivimab-Etesevimab prevents 1 of every 29. Molnupiravir (by Merck) prevents 1 out of 50. Inhaled corticosteroids prevents 1 out of 72. Fluvoxamine (Luvox) prevents 1 out of 80. Colchicine prevents 1 out of 91.

                    Canada has ordered 1 million Paxlovid ( a double pill package), take twice a day for 5 days. Pfizer claims that it reduces the risk of hospitalizations and death by up to 88%. Cheaper than getting a monoclonal antibodies injection.



                    Comment


                    • Originally posted by Erik Malmsten View Post

                      Study of 1,282 patients led by Sunnybrook in the Canadian Medical Association Journal states that remdesivir injection could have a "modest but significant effect" decreasing the need for mechanical ventilation by approximately 50 per cent. The study also found patients on remdesivir came off oxygen and ventilators sooner. In-hospital mortality was slightly lower in the remdesivir group at 18.7 per cent, compared to 22.6 in the control group.

                      A McGill study in the Oxford Journal Open Forum Infectious Diseases states Redesivir prevents the hospitalization of 1 out of every 28 patients. Hospital costs average $21,752 per admission.The new Pfizer antiviral pill Paxlovid (Nirmatreivir-Ritonavir) prevents 1 out of every 24. Sotrovimab 1 out of 25. Casirivimab-Imdevimab or Bamlanivimab-Etesevimab prevents 1 of every 29. Molnupiravir (by Merck) prevents 1 out of 50. Inhaled corticosteroids prevents 1 out of 72. Fluvoxamine (Luvox) prevents 1 out of 80. Colchicine prevents 1 out of 91.

                      Canada has ordered 1 million Paxlovid ( a double pill package), take twice a day for 5 days. Pfizer claims that it reduces the risk of hospitalizations and death by up to 88%. Cheaper than getting a monoclonal antibodies injection.


                      Originally posted by Erik Malmsten View Post
                      Here are the actual results.

                      Results: Across 52 Canadian hospitals, we randomized 1282 patients between Aug. 14, 2020, and Apr. 1, 2021, to remdesivir (n = 634) or standard of care (n = 648). Of these, 15 withdrew consent or were still in hospital, for a total sample of 1267 patients. Among patients assigned to receive remdesivir, in-hospital mortality was 18.7%, compared with 22.6% in the standard-of-care arm (relative risk [RR] 0.83 (95% confidence interval [CI] 0.67 to 1.03), and 60-day mortality was 24.8% and 28.2%, respectively (95% CI 0.72 to 1.07). For patients not mechanically ventilated at baseline, the need for mechanical ventilation was 8.0% in those assigned remdesivir, and 15.0% in those receiving standard of care (RR 0.53, 95% CI 0.38 to 0.75). Mean oxygen-free and ventilator-free days at day 28 were 15.9 (± standard deviation [SD] 10.5) and 21.4 (± SD 11.3) in those receiving remdesivir and 14.2 (± SD 11) and 19.5 (± SD 12.3) in those receiving standard of care (p = 0.006 and 0.007, respectively). There was no difference in safety events of new dialysis, change in creatinine, or new hepatic dysfunction between the 2 groups.

                      Mortality of 18.7% is absolutely horrific.

                      Here is a protocol for hospitalized patients that reduced mortality to 5.1%
                      https://covid19criticalcare.com/wp-c...ne-Dec2020.pdf
                      The average hospital mortality at these 2 centers in over 300 patients treated is 5.1%, which represents more than a 75% absolute risk reduction in mortality compared to the average published hospital mortality of 22.9% among COVID-19 patients.

                      The reason multi-drug combos such as the FLCC protocol are not used in Canada is that they use cheap repurposed drugs that do not serve big pharma's interest of making profits and not saving lives.
                      Last edited by Sid Belzberg; Thursday, 20th January, 2022, 11:16 PM.

                      Comment


                      • Originally posted by Bob Armstrong View Post
                        COVID-19 Conspiracy Theories
                        (A recap, plus more, from prior posts)

                        COVID-19 Conspiracy Theory # 1 (Deliberate Release)

                        There is a world conspiracy to suppress the best practice for prevention of/ treatment of COVID-19 among:

                        1. All world governments;
                        2. All global health organizations that are mainstream.
                        3. Almost all world scientists (Those opposed to mainstream medicine are still a small minority in the world).
                        4. Almost all world physicians
                        5. All multi-national pharmaceutical companies
                        6. The world's Oligarchy.

                        This conspiracy is most willing to tolerate a very high death and serious sickness total (Much higher than necessary) in order to achieve their covert goals, one of which is to maximize the profits of the multi-national pharmaceuticals; another can be to increase the control of the governments over their citizens by imposing restraints on the basis of a world emergency.


                        My Response

                        Possible but unlikely.....the coordination would have to be totally covert and impeccable. Surely there would be a whistleblower! There has been none yet. It is, however, not pure speculation, as the conspirators all would have the same goal......all rowing in the same direction.

                        There is a whole universe of non-human viruses out there, which are transferable to humans, and make them sick. So there could have been a natural virus transfer from an animal to a human.

                        But it is true that our world capitalist system sees nothing wrong with the multi-national pharmaceutical companies making obscene profits off human illness.

                        Also, I have personally seen a very professional video making this claim, even to the very bench the female lab technician from the Wuhan lab sat on outside of Wuhan, where she set on the bench the dry ice container containing the virus, to let it escape! Big money is propelling this theory! I will admit it is quite possible, though unlikely......it is just too Machiavellian even for mankind.

                        COVID-19 Conspiracy Theory # 2 (Petri Dish)

                        The SARSCov-2 virus was artificially created in a "Petri Dish" in a laboratory.

                        Evidence of this, and that USA and China were working together, is claimed to be found in the interpretation of Dr. Fauci's e-mails: https://www.youtube.com/watch?v=P5TvU4q2J1s.

                        My Response

                        Certainly possible, but the evidence to me is so far insufficient. It is quite logical that military see value in Bio-weapons. I have also seen allegations of the military combining SARS and the HIV virus as well.

                        But there are many scientific articles on the universe of natural non-human viruses out there waiting to make humans sick. There are articles claiming evidence for SARS-CoV-2 related coronaviruses circulating in bats and pangolins in Southeast Asia and being the natural source of the virus : https://www.nature.com/articles/s414...240-1..(21/2/9).

                        It has been argued that the structure of this virus is different than the similar ones found in animals. But there is scientific evidence against this alleged evidence.

                        But it does seem to me that the case is not yet totally made against Conspiracy Theory # 2

                        COVID-19 Conspiracy Theory # 3 (Inadvertent Escape)

                        A military-created virus (A bio-weapon) accidentally escaped from the Wuhan Lab in China somehow (Not deliberate).

                        My Response

                        Perhaps - China has so stonewalled on any on-site investigation in Wuhan that there is little "direct" evidence on anything. There is admittedly some "circumstantial" evidence.

                        COVID-19 Conspiracy Theory # 4 (ET Hostility)

                        Some covert ET Societies of Earth conspired together to make the world sick, in order to reduce Earth's over-population problem, and make more room for more ET immigrants.

                        My Response

                        There is good evidence that most covert ET Societies of Earth are well-intentioned re mankind.

                        But 5.5 MILLION world deaths in 2020-2021 from COVID-19 does practically nothing to cull humanity, when the population of the Earth is now 7.7 BILLION.

                        ~ Bob A (T-S/P)
                        https://www.theepochtimes.com/new-em...ls_Reveal&est=[EMAIL_SECURE_LINK]

                        Comment


                        • Hi Sid:

                          The Epoch Times is not that old.

                          When it first came out, the hard copy newspaper was distributed free in the mail, in my part of Toronto anyway.

                          I read a number of early issues.........on every single issue the perspective was very, very conservative, and religiously fundamentalist.

                          When a media is out on the extreme of the political spectrum, it does not mean they may not report truth, and do legitimate speculation on it.

                          But I am most cautious to see what real evidence there is for the spin.

                          ~ Bob A (T-S/P)

                          Comment


                          • Originally posted by Bob Armstrong View Post
                            Hi Sid:

                            The Epoch Times is not that old.

                            When it first came out, the hard copy newspaper was distributed free in the mail, in my part of Toronto anyway.

                            I read a number of early issues.........on every single issue the perspective was very, very conservative, and religiously fundamentalist.

                            When a media is out on the extreme of the political spectrum, it does not mean they may not report truth, and do legitimate speculation on it.

                            But I am most cautious to see what real evidence there is for the spin.

                            ~ Bob A (T-S/P)
                            Great, now tell me anything that you find inaccurate in the article. Simply attacking the messenger when you can’t attack the message is not a good look.
                            Last edited by Sid Belzberg; Friday, 21st January, 2022, 01:57 PM.

                            Comment



                            • Originally posted by Patrick Gougeon View Post
                              "Importantly, infection-derived protection was greater after the highly transmissible Delta variant became predominant, coinciding with early declining of vaccine-induced immunity in many persons (5). Similar data accounting for booster doses and as new variants, including Omicron, circulate will need to be assessed."

                              In fact Natural immunity was six times stronger during the delta wave than vaccination, according to this report from the U.S. Centers for Disease Control and Prevention. Why insist a COVID recovered person gets vaccinated other than to make more profits for Pfizer?


                              Below, 86% of these filings are from Healthcare professionals. THE CDC's own early warning system that they love to ignore. Thye CDC would have you believe only 3 deaths can be attributed to the Covid vaccines.

                              https://jessicar.substack.com/p/caus...prove-me-wrong
                              https://alexberenson.substack.com/p/...sedly/comments


                              https://openvaers.com/covid-data


                              Here are more "facts" for you


                              which means 89.84% of statistically significant countries (128 countries) showed an increase in total deaths per million associated with COVID-19 due directly to the causal impact of vaccine treatment initiation.

                              https://vector-news.github.io/editor...port_html.html

                              Screen Shot 2022-01-21 at 10.32.19 PM.png
                              Last edited by Sid Belzberg; Saturday, 22nd January, 2022, 12:30 AM.

                              Comment

                              Working...
                              X